Review



data partial cytochrome b sequences  (Sage Science)


Bioz Verified Symbol Sage Science is a verified supplier
Bioz Manufacturer Symbol Sage Science manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Sage Science data partial cytochrome b sequences
    Data Partial Cytochrome B Sequences, supplied by Sage Science, used in various techniques. Bioz Stars score: 96/100, based on 1655 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/data+partial+cytochrome+b+sequences/Pippin+Prep/pm41747721-258-108-104
    Average 96 stars, based on 1655 article reviews
    data partial cytochrome b sequences - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Repeated evolution of supergenes on an ancient social chromosome.
    Article Snippet: .. A polygyne queen collected from the wild was kept in the lab for a duration of three months, and her offspring laid in the lab were used for building REAGENT or RESOURCES SOURCE IDENTIFIER Biological samples Ants Cataglyphis niger This study N/A Chemicals, peptides, and recombinant proteins EcoRI- HF New England Biolabs R3101 BfaI New England Biolabs R0568L T4 DNA ligase Merck 10716359001 ATP 100mM Merck GE27-2056-01 Q5 High-Fidelity DNA Polymerase New England Biolabs M0491L oneTaq 2X master mix New England Biolabs M0482L Agencourt AMPure XP Beckman Coulter A63881 Critical commercial assays DNeasy blood and tissue kit QIAGEN Cat#69504 Pippin Prep with 1.5% agarose Sage Science PIP0001 Deposited data Partial Cytochrome b sequences This study NCBI: PX764056 – PX764141 Raw illumina reads This study NCBI: PRJNA1348302 and PRJNA1348166 Oligonucleotides ddRAD barcoded adapters and primers Brelsford et al. 27 N/A Cytochrome b Forward TATGTACTACCATGAGGACAAATATC CB-J-10933 Cytochrome b Reverse ATTACACCTCCTAATTTATTAGGAAT CB-J-11367 Software and algorithms Mega X Kumar et al. 60 N/A Muscle algorithm Edgar 61 N/A raxmlGUI 2.0 Edgar et al. 62 N/A FastQC v0.11.5 Andrews 63 N/A Trimmomatic v0.39 Bolger et al. 64 N/A FLASH v1.2.11 Mago� c and Salzberg 65 N/A Stacks v2.2 Rochette et al. 66 N/A Bowtie2 Langmead and Salzberg 67 N/A VCFtools v 0.1.1472 Danecek et al. 68 N/A Beagle version 5.073 Browning et al. 69 N/A refined-IBD 17Jan20.102.jar Browning and Browning 70 N/A Plink v1.979 Purcell et al. 71 N/A GAPIT 3.0 R package Lipka et al. 72 N/A OMA v2.6.0 Altenhoff et al. 73 N/A ODP algorithm Schultz et al. 74 N/A HAPpy-ABCENTH v1.0 McKenzie 75 https://github.com/biorover/HAPpy-ABCENTH MAFFT v7.511 Katoh and Standley 76 N/A RAxML v8.2.12 Stamatakis 77 N/A Current Biology 36, 1–14.e1–e4, March 9, 2026 e1 Article the linkage map. ..

    Software:

    Article Title: Repeated evolution of supergenes on an ancient social chromosome.
    Article Snippet: .. A polygyne queen collected from the wild was kept in the lab for a duration of three months, and her offspring laid in the lab were used for building REAGENT or RESOURCES SOURCE IDENTIFIER Biological samples Ants Cataglyphis niger This study N/A Chemicals, peptides, and recombinant proteins EcoRI- HF New England Biolabs R3101 BfaI New England Biolabs R0568L T4 DNA ligase Merck 10716359001 ATP 100mM Merck GE27-2056-01 Q5 High-Fidelity DNA Polymerase New England Biolabs M0491L oneTaq 2X master mix New England Biolabs M0482L Agencourt AMPure XP Beckman Coulter A63881 Critical commercial assays DNeasy blood and tissue kit QIAGEN Cat#69504 Pippin Prep with 1.5% agarose Sage Science PIP0001 Deposited data Partial Cytochrome b sequences This study NCBI: PX764056 – PX764141 Raw illumina reads This study NCBI: PRJNA1348302 and PRJNA1348166 Oligonucleotides ddRAD barcoded adapters and primers Brelsford et al. 27 N/A Cytochrome b Forward TATGTACTACCATGAGGACAAATATC CB-J-10933 Cytochrome b Reverse ATTACACCTCCTAATTTATTAGGAAT CB-J-11367 Software and algorithms Mega X Kumar et al. 60 N/A Muscle algorithm Edgar 61 N/A raxmlGUI 2.0 Edgar et al. 62 N/A FastQC v0.11.5 Andrews 63 N/A Trimmomatic v0.39 Bolger et al. 64 N/A FLASH v1.2.11 Mago� c and Salzberg 65 N/A Stacks v2.2 Rochette et al. 66 N/A Bowtie2 Langmead and Salzberg 67 N/A VCFtools v 0.1.1472 Danecek et al. 68 N/A Beagle version 5.073 Browning et al. 69 N/A refined-IBD 17Jan20.102.jar Browning and Browning 70 N/A Plink v1.979 Purcell et al. 71 N/A GAPIT 3.0 R package Lipka et al. 72 N/A OMA v2.6.0 Altenhoff et al. 73 N/A ODP algorithm Schultz et al. 74 N/A HAPpy-ABCENTH v1.0 McKenzie 75 https://github.com/biorover/HAPpy-ABCENTH MAFFT v7.511 Katoh and Standley 76 N/A RAxML v8.2.12 Stamatakis 77 N/A Current Biology 36, 1–14.e1–e4, March 9, 2026 e1 Article the linkage map. ..



    Similar Products

    data partial cytochrome b sequences  (Sage Science)
    96
    Sage Science data partial cytochrome b sequences
    Data Partial Cytochrome B Sequences, supplied by Sage Science, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/data+partial+cytochrome+b+sequences/Pippin+Prep/pm41747721-258-108-104
    Average 96 stars, based on 1 article reviews
    data partial cytochrome b sequences - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results